| Types | DnaRegion
|
| Roles | Regulatory
promoter
|
| Sequences | BBa_J100092_sequence (Version 1)
|
Description
Constitutive promoter for M1-162
Notes
We had to cut out several sections of the promoter to make it smaller than 70 nucleotides (including the sticky ends).
We removed these segments of the promoter sequence: TGTACAGTACTTCAATTTGTTTAAAC, and CAGGAAACAGCT
These two sequences were associated with the ribosomal binding sites and the messenger RNA stabilizing regions, which were not essential to have in our promoter because the RFP gene (the gene our promoter is transcribing) contains all the necessary genetic information to undergo translation and transcription after transcription has been initiated.
Source
From lacZ gene, in lac operon from e. coli bacteria