##gff-version 3
##sequence-region BBa_J07040 1 515
BBa_J07040	.	terminator	387	466	.	+	0	ID=BBa_B0010;Name=BBa_B0010
BBa_J07040	.	stem_loop	398	441	.	+	0	ID=annotation4184;Name=stem_loop;Parent=BBa_B0010
BBa_J07040	.	engineered_region	387	466	.	+	0	ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010
BBa_J07040	.	promoter	1	200	.	+	0	ID=BBa_R0010;Name=BBa_R0010
BBa_J07040	.	promoter	161	166	.	+	0	ID=annotation1961225;Name=-10;Parent=BBa_R0010
BBa_J07040	.	non_covalent_binding_site	166	200	.	+	0	ID=annotation1961226;Name=LacI binding site;Parent=BBa_R0010
BBa_J07040	.	CDS	1	88	.	+	0	ID=annotation1961221;Name=end of LacI coding region (inactive);Parent=BBa_R0010
BBa_J07040	.	non_covalent_binding_site	89	126	.	+	0	ID=annotation1961223;Name=CAP binding site;Parent=BBa_R0010
BBa_J07040	.	promoter	137	142	.	+	0	ID=annotation1961224;Name=-35;Parent=BBa_R0010
BBa_J07040	.	engineered_region	1	200	.	+	0	ID=annotation1961222;Name=BBa_R0010;Parent=BBa_R0010
BBa_J07040	.	start_codon	173	173	.	+	0	ID=annotation1961227;Name=start;Parent=BBa_R0010
BBa_J07040	.	mature_transcript_region	209	378	.	+	0	ID=BBa_I1033;Name=BBa_I1033
BBa_J07040	.	engineered_region	209	378	.	+	0	ID=annotation7053;Name=BBa_I1033;Parent=BBa_I1033
BBa_J07040	.	sequence_feature	264	271	.	+	0	ID=annotation1896;Name=reverse complement to cI cds;Parent=BBa_I1033
BBa_J07040	.	stem_loop	266	328	.	+	0	ID=annotation1899;Name=stem_loop;Parent=BBa_I1033
BBa_J07040	.	stem_loop	287	307	.	+	0	ID=annotation1893;Name=stem_loop;Parent=BBa_I1033
BBa_J07040	.	operator	209	263	.	+	0	ID=annotation1902;Name=LacO-1;Parent=BBa_I1033
BBa_J07040	.	sequence_feature	264	298	.	+	0	ID=annotation1892;Name=Reverse Complement to cI mRNA;Parent=BBa_I1033
BBa_J07040	.	sequence_alteration	266	268	.	+	0	ID=annotation1900;Name=added codon (Cys);Parent=BBa_I1033
BBa_J07040	.	start_codon	264	264	.	+	0	ID=annotation1901;Name=start;Parent=BBa_I1033
BBa_J07040	.	start_codon	269	271	.	+	0	ID=annotation1898;Name=start;Parent=BBa_I1033
BBa_J07040	.	sequence_feature	276	281	.	+	0	ID=annotation1895;Name=Reverse Complement RBS;Parent=BBa_I1033
BBa_J07040	.	terminator	475	515	.	+	0	ID=BBa_B0012;Name=BBa_B0012
BBa_J07040	.	polyA_site	502	515	.	+	0	ID=annotation1690;Name=polya;Parent=BBa_B0012
BBa_J07040	.	stem_loop	482	501	.	+	0	ID=annotation1686;Name=T7 TE;Parent=BBa_B0012
BBa_J07040	.	stop_codon	508	508	.	+	0	ID=annotation1687;Name=stop;Parent=BBa_B0012
BBa_J07040	.	engineered_region	475	515	.	+	0	ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012
>BBa_J07040
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagc
gggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggct
cgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagataaatgtgagcggataacattgacattg
tgagcggataacaagatactgagcacgagcacatcttgttgtctgattattgatttttcgcgaaaccatttgatcatat
gacaagatgtgtatccaccttaacttaatgatttttaccaaaatcattaggggattcatcagtactagagccaggcatc
aaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagag
tcacactggctcaccttcgggtgggcctttctgcgtttata